sgCTNNB1 Nicking
(Plasmid #169845)

Purpose

Express a nicking sgRNA used for installation of the oncogenic S45F or S45del in Ctnnb1 in mouse liver.
Depositing Lab

Wen Xue
Publication

Liu et al BioRxiv ( How to cite )
Sequence Information
- Sequences (1)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	169845	Standard format: Plasmid sent in bacteria as agar stab	1	$85	Add to Cart

This material is available to academics and nonprofits only.

Backbone

Vector backbone
pmd127
(Search Vector Database)
Vector type
Mammalian Expression

Growth in Bacteria

Bacterial Resistance(s)
Ampicillin, 100 μg/mL
Growth Temperature
37°C
Growth Strain(s)
NEB Stable
Copy number
High Copy

Gene/Insert

Gene/Insert name
sgCTNNB1 Nicking
gRNA/shRNA sequence
GAAAAGCTGCTGTCAGCCAC
Species
M. musculus (mouse)
GenBank ID
Entrez Gene
Ctnnb1 (a.k.a. Bfc, Catnb, Mesc)

Cloning Information

Cloning method Gibson Cloning
5′ sequencing primer HU6F

(Common Sequencing Primers)

Terms and Licenses

Academic/Nonprofit Terms
- UBMTA
Industry Terms
- Not Available to Industry

Trademarks:

Zeocin® is an InvivoGen trademark.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

For your Materials & Methods section:

sgCTNNB1 Nicking was a gift from Wen Xue (Addgene plasmid # 169845 ; http://n2t.net/addgene:169845 ; RRID:Addgene_169845)
For your References section:

Improved prime editors enable pathogenic allele correction and cancer modelling in adult mice. Liu P, Liang S, Zheng C, Mintzer E, Zhao YG, Ponnienselvan K, Mir A, Sontheimer EJ, Gao G, Flotte TR, Wolfe SA, Xue W. BioRxiv 10.1101/2020.12.15.422970

Map uploaded by the depositor.

sgCTNNB1 Nicking (Plasmid #169845)