pKB223
(Plasmid #170013)

• Purpose: Encodes LacI-controlled expression of surface-displayed C18G and PvirK-mNeonGreen reporter
• Depositing Lab: Jeffrey Tabor
• Publication: Brink et al bioRxiv

Backbone

• Vector backbone: pSC101*
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: mNeonGreen
• Species: Branchiostoma lanceolatum
• Promoter: PvirK

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CGTCTAAGAAACCATTATTATCATGACATTAAC

Gene/Insert 2

• Gene/Insert name: C18G
• Species: Synthetic; Escherichia coli
• Promoter: Ptac
• Tags / Fusion Proteins:
  • Lpp (N terminal on insert)
  • OmpA (N terminal on insert)
  • Tether (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CGGTATCAGCTCACTCAAAGG

Resource Information

• Supplemental Documents:
  • pKB223 (seq_uJam85VJ).gb
• A portion of this plasmid was derived from a plasmid made by: Peptide display fusion protein sequence was obtained from Bryan Davies and was originally published in Tucker et al. 2018 (DOI:10.1016/j.cell.2017.12.009).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Peptide display fusion protein sequence was obtained from Bryan Davies and was originally published in Tucker et al. 2018 (DOI:10.1016/j.cell.2017.12.009).

Tucker AT, Leonard SP, DuBois CD, Knauf GA, Cunningham AL, Wilke CO, Trent MS, Davies BW. Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries. Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. PMID: 29307492; PMCID: PMC5786472. Please visit https://www.biorxiv.org/content/10.1101/2021.06.01.446581v1 for bioRxiv preprint.