Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #103980)


Item Catalog # Description Quantity Price (USD)
Plasmid 103980 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3674
  • Total vector size (bp) 4391
  • Modifications to backbone
    Derived from pUA66. Inserted constitutive promoter proC. Replaced original insert with FP of interest.
  • Vector type
    Bacterial Expression ; Low copy

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    Mutations relative to wild-type GFP (S65A, V68L, S72A, A206K)
  • Promoter proC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGTATCACGAGGCCCTTTC
  • 3′ sequencing primer AAAGGGAAAACTGTCCATATGCAC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This FP derives from wtGFP. In this plasmid, the FP is coded with the original wtGFP nucleotide coding sequence except where mutations specific to the FP occur (see map). Please see "Notes On Plasmids In This Collection" document for further details and references.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEB1-mGFPmut2 was a gift from Philippe Cluzel (Addgene plasmid # 103980 ; ; RRID:Addgene_103980)
  • For your References section:

    Systematic characterization of maturation time of fluorescent proteins in living cells. Balleza E, Kim JM, Cluzel P. Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20. 10.1038/nmeth.4509 PubMed 29320486