-
PurposeDrives myrGFP-P2A-H2AmCherry expression with the slc1a3b promoter in astrocytes. The myrGFP labels the membrane and mCherry labels the nucleus
-
Depositing Lab
-
Depositing OrganizationOregon Health & Science University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 170208-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 170208-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepT2A
- Backbone size w/o insert (bp) 3299
- Total vector size (bp) 15280
-
Vector typeZebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameslc1a3b
-
Alt nameGlast
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)9550
-
Entrez Geneslc1a3b (a.k.a. EAAT, gla, si:dkey-21n12.2)
- Promoter slc1a3b
-
Tag
/ Fusion Protein
- myrGFP-P2A-H2AmCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATTAACCCTCACTAAAGGGA
- 3′ sequencing primer CCCTATAGTGAGTCGTATTAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 170208-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 170208-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
slc1a3b:myrGFP-P2A-H2AmCherry was a gift from Kelly Monk (Addgene plasmid # 170208 ; http://n2t.net/addgene:170208 ; RRID:Addgene_170208) -
For your References section:
Live-imaging of astrocyte morphogenesis and function in zebrafish neural circuits. Chen J, Poskanzer KE, Freeman MR, Monk KR. Nat Neurosci. 2020 Oct;23(10):1297-1306. doi: 10.1038/s41593-020-0703-x. Epub 2020 Sep 7. 10.1038/s41593-020-0703-x PubMed 32895565