Skip to main content

slc1a3b:myrGCaMP6s-P2A-H2AmCherry
(Plasmid #170209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170209 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 170209-D50 50 μg of DNA in Tris buffer $495
DNA 170209-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pT2A
  • Backbone size w/o insert (bp) 3299
  • Total vector size (bp) 15921
  • Vector type
    Zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    slc1a3b
  • Alt name
    Glast
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    9550
  • Entrez Gene
    slc1a3b (a.k.a. EAAT, gla, si:dkey-21n12.2)
  • Promoter slc1a3b
  • Tag / Fusion Protein
    • myrGCaMP6s-P2A-H2AmCherry (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATTAACCCTCACTAAAGGGA
  • 3′ sequencing primer CCCTATAGTGAGTCGTATTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    slc1a3b:myrGCaMP6s-P2A-H2AmCherry was a gift from Kelly Monk (Addgene plasmid # 170209 ; http://n2t.net/addgene:170209 ; RRID:Addgene_170209)
  • For your References section:

    Live-imaging of astrocyte morphogenesis and function in zebrafish neural circuits. Chen J, Poskanzer KE, Freeman MR, Monk KR. Nat Neurosci. 2020 Oct;23(10):1297-1306. doi: 10.1038/s41593-020-0703-x. Epub 2020 Sep 7. 10.1038/s41593-020-0703-x PubMed 32895565