Skip to main content

pSBbi-TIR1/Pur
(Plasmid #171682)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171682 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSBbi
  • Total vector size (bp) 7524
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OsTIR1-MYC
  • Species
    Oryza sativa
  • Promoter EF-1a promoter
  • Tag / Fusion Protein
    • MYC (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer caccatggcatactttcctga
  • 3′ sequencing primer GATCGTTaagCTTTTTAGCTAGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-TIR1/Pur was a gift from Randy Poon (Addgene plasmid # 171682 ; http://n2t.net/addgene:171682 ; RRID:Addgene_171682)
  • For your References section:

    One-step multiplex toolkit for efficient generation of conditional gene silencing human cell lines. Yeung TK, Lau HW, Ma HT, Poon RYC. Mol Biol Cell. 2021 May 12:mbcE21020051. doi: 10.1091/mbc.E21-02-0051. 10.1091/mbc.E21-02-0051 PubMed 33979199