pUHD-SB-mAID/Hyg
(Plasmid
#171679)
-
PurposeTRE-controlled mAID-fusion sleeping beauty transposon vector with selection marker (hygromycin)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSBbi
- Total vector size (bp) 5513
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemAID
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATCG
- 3′ sequencing primer catgtctATCGATCTTATCATGTCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUHD-SB-mAID/Hyg was a gift from Randy Poon (Addgene plasmid # 171679 ; http://n2t.net/addgene:171679 ; RRID:Addgene_171679) -
For your References section:
One-step multiplex toolkit for efficient generation of conditional gene silencing human cell lines. Yeung TK, Lau HW, Ma HT, Poon RYC. Mol Biol Cell. 2021 May 12:mbcE21020051. doi: 10.1091/mbc.E21-02-0051. 10.1091/mbc.E21-02-0051 PubMed 33979199