Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSBbi-TIR1-tTA/Pur
(Plasmid #171683)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171683 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSBbi
  • Total vector size (bp) 8327
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    tetracycline-controlled transactivator
  • Alt name
    tTA
  • Promoter RPBSA promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer CCGtcgaCATATGTCTAGATTAGATAAA
  • 3′ sequencing primer ttGCGGCCGCatcgatGGGCCAGGATTCTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Puromycin
  • Promoter RPBSA promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaggcATCGatgaccgagtacaag
  • 3′ sequencing primer gagtgaattcacgacaggc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    EF-1a promoter
  • Promoter EF-1a promoter

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer aagtatgccatggtggcctcaga
  • 3′ sequencing primer gcctcGAgtgcagaggtttctac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-TIR1-tTA/Pur was a gift from Randy Poon (Addgene plasmid # 171683 ; http://n2t.net/addgene:171683 ; RRID:Addgene_171683)
  • For your References section:

    One-step multiplex toolkit for efficient generation of conditional gene silencing human cell lines. Yeung TK, Lau HW, Ma HT, Poon RYC. Mol Biol Cell. 2021 May 12:mbcE21020051. doi: 10.1091/mbc.E21-02-0051. 10.1091/mbc.E21-02-0051 PubMed 33979199