pSBbi-TIR1-tTA/Pur
(Plasmid
#171683)
-
Purposeconstitutive expression of TIR1-myc and tTA in sleeping beauty transposon vector with selection marker (puromycin)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBbi
- Total vector size (bp) 8327
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nametetracycline-controlled transactivator
-
Alt nametTA
- Promoter RPBSA promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer CCGtcgaCATATGTCTAGATTAGATAAA
- 3′ sequencing primer ttGCGGCCGCatcgatGGGCCAGGATTCTCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuromycin
- Promoter RPBSA promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaggcATCGatgaccgagtacaag
- 3′ sequencing primer gagtgaattcacgacaggc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEF-1a promoter
- Promoter EF-1a promoter
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer aagtatgccatggtggcctcaga
- 3′ sequencing primer gcctcGAgtgcagaggtttctac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-TIR1-tTA/Pur was a gift from Randy Poon (Addgene plasmid # 171683 ; http://n2t.net/addgene:171683 ; RRID:Addgene_171683) -
For your References section:
One-step multiplex toolkit for efficient generation of conditional gene silencing human cell lines. Yeung TK, Lau HW, Ma HT, Poon RYC. Mol Biol Cell. 2021 May 12:mbcE21020051. doi: 10.1091/mbc.E21-02-0051. 10.1091/mbc.E21-02-0051 PubMed 33979199