PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
(Plasmid
#172669)
-
PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition site
-
Depositing Lab
-
Depositing OrganizationNorthwest Agriculture and Forestry University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 172669-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 172669-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-U6-sgRNA-EGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNF2 pegRNA and RNF2_nick-sgRNA
-
gRNA/shRNA sequencegtcatcttagtcattacctggtttcagagctagaaatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacgaacatctcaggtaatgactaagatggttcactgccgtataggcagtcaaccattaagcaaaacatgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 172669-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 172669-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP was a gift from Xiaolong Wang (Addgene plasmid # 172669 ; http://n2t.net/addgene:172669 ; RRID:Addgene_172669) -
For your References section:
Enhancing prime editing by Csy4-mediated processing of pegRNA. Liu Y, Yang G, Huang S, Li X, Wang X, Li G, Chi T, Chen Y, Huang X, Wang X. Cell Res. 2021 Jun 8. pii: 10.1038/s41422-021-00520-x. doi: 10.1038/s41422-021-00520-x. 10.1038/s41422-021-00520-x PubMed 34103663
