pET22b-6h-GST-TEVp
(Plasmid #172887)

• Purpose: Codon optimized (E. coli) TEVp fused with GST and his-tagged for purification
• Depositing Lab: Urartu Seker
• Publication: Ahan et al ACS Synth Biol. 2019 Apr 19;8(4):686-696. doi: 10.1021/acssynbio.9b00062. Epub 2019 Mar 12.

Backbone

• Vector backbone: pET22b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5359
• Total vector size (bp): 6779
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TEV protease
• Alt name: Tevp
• Alt name: Tobacco etch virus protease
• Species: Synthetic
• Insert Size (bp): 708
• Promoter: T7 promoter
• Tags / Fusion Proteins:
  • GST solubility tag (N terminal on insert)
  • HHHHHH (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pet-22b-6his-gst-tev.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry