pGLOW39
(Plasmid #173068)

• Purpose: mScarlet^SEC^3xMyc vector with ccdB sites for cloning homology arms
• Depositing Lab: Ryan Doonan
• Publication: Witten et al MicroPubl Biol. 2023 Jun 14;2023:10.17912/micropub.biology.000871. doi: 10.17912/micropub.biology.000871. eCollection 2023.

Backbone

• Vector backbone: pUC19 (modified)
• Backbone size w/o insert (bp): 2661
• Total vector size (bp): 10468
• Modifications to backbone: Addition of ccdB markers to facilitate homology arm cloning
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin ; sqt-1(d) (worm phenotypic marker)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): ccdB Survival
• Growth instructions: The dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and check test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mScarlet-I-C1^SEC^3xMyc
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 6587
• Tags / Fusion Proteins:
  • C. elegans codon-optimized mScarlet
  • 3xMyc

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTTTCCCAGTCACGAC (M13 fwd)
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGGA (M13 rev)

Resource Information

• Supplemental Documents:
  • pGLOW39.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Derived from pDD287 (Addgene #70685) and pMS050 (Addgene #91826)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

C. elegans codon-optimized mScarlet. pGLOW39 is a derivative of published TagRFP-SEC vectors (Dickinson et al. Genetics 2015). It has a 3xMyc tag in place of 3xFlag and Lox2272 sites in place of LoxP. These features allow pGLOW39 to be used in a genetic background that has already been modified using a green FP-SEC vector, without conflicts between epitope tags and Lox sites. Made by George Huang (Glow Worms '20).