Halo-WIPI2B L69E
(Plasmid
#175026)
-
PurposeExpresses WIPI2B (L69E) fused to Halo in mammalian cells to abrogate interaction with ATG16L1
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Health Science Center at Houston
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 175026-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 175026-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepHTN
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6143
- Total vector size (bp) 7410
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWIPI2B (L69E)
-
SpeciesH. sapiens (human)
-
MutationLeucine 69 to Glutamate (CTA to GAA)
-
Entrez GeneWIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cctgatcggcagcgagatcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySharon Tooze, Francis Crick Institute, UK
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 175026-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 175026-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-WIPI2B L69E was a gift from Andrea Stavoe (Addgene plasmid # 175026 ; http://n2t.net/addgene:175026 ; RRID:Addgene_175026) -
For your References section:
Structural basis for membrane recruitment of ATG16L1 by WIPI2 in autophagy. Strong LM, Chang C, Riley JF, Boecker CA, Flower TG, Buffalo CZ, Ren X, Stavoe AK, Holzbaur EL, Hurley JH. Elife. 2021 Sep 10;10. pii: 70372. doi: 10.7554/eLife.70372. 10.7554/eLife.70372 PubMed 34505572