pCAG-loxpSTOPloxp-lyn-NeonGreen
(Plasmid
#175257)
-
Purposemembrane target protein labelling
-
Depositing Labs
-
Depositing OrganizationDeutsches Zentrum fuer Neurodegenerative Erkrankungen (DZNE)
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 175257-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 175257-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG-loxSTOPlox-EGFP
- Backbone size w/o insert (bp) 5711
-
Vector typeMammalian Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLyn membrane targeting motif
-
SpeciesH. sapiens (human)
-
Insert Size (bp)756
-
MutationNone (wt)
- Promoter pCAG
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site SwaI (not destroyed)
- 5′ sequencing primer pCAG forward (GCAACGTGCTGGTTATTGTG)
- 3′ sequencing primer NeonGFP reverse (5’-GGAGAGAGGCCATGTTATCC-3’)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Membrane targetting sequence is Lyn (MGCIKSKRKD)
DNA (Catalog # 175257-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 175257-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-loxpSTOPloxp-lyn-NeonGreen was a gift from Frank Bradke & Sebastián Dupraz (Addgene plasmid # 175257 ; http://n2t.net/addgene:175257 ; RRID:Addgene_175257) -
For your References section:
In Situ Visualization of Axon Growth and Growth Cone Dynamics in Acute Ex Vivo Embryonic Brain Slice Cultures. Alfadil E, Bradke F, Dupraz S. J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068. 10.3791/63068 PubMed 34723948