Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #175438)


Item Catalog # Description Quantity Price (USD)
Plasmid 175438 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5737
  • Total vector size (bp) 7602
  • Vector type
    Mammalian Expression, Cre/Lox ; Dre/Rox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter pCAG
  • Tag / Fusion Protein
    • ZsGreen on backbone (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pCAG forward (GCAACGTGCTGGTTATTGTG)
  • 3′ sequencing primer ZsGreen reverse (5’- CTCCATGCGGTACTTCATGG -3’)
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional Primers:
tRFP forward (5'-ACTTCGTGGACCACAGAC-3’) and tRFP reverse

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-lox-rox-STOP-rox-tRFP-pA-lox-ZsGreen-pA was a gift from Frank Bradke & Sebastián Dupraz (Addgene plasmid # 175438 ; ; RRID:Addgene_175438)
  • For your References section:

    In Situ Visualization of Axon Growth and Growth Cone Dynamics in Acute Ex Vivo Embryonic Brain Slice Cultures. Alfadil E, Bradke F, Dupraz S. J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068. 10.3791/63068 PubMed 34723948