pCAG-loxpSTOPloxp-lyn-NeonGreen
(Plasmid #175257)

• Purpose: membrane target protein labelling
• Depositing Labs: Frank Bradke, Sebastián Dupraz
• Publication: Alfadil et al J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068.

Backbone

• Vector backbone: pCAG-loxSTOPlox-EGFP
• Backbone size w/o insert (bp): 5711
• Vector type: Mammalian Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Lyn membrane targeting motif
• Species: H. sapiens (human)
• Insert Size (bp): 756
• Mutation: None (wt)
• Promoter: pCAG
• Tag / Fusion Protein:
  • mNeonGreen (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: SwaI (not destroyed)
• 5′ sequencing primer: pCAG forward (GCAACGTGCTGGTTATTGTG)
• 3′ sequencing primer: NeonGFP reverse (5’-GGAGAGAGGCCATGTTATCC-3’)

Resource Information

• Supplemental Documents:
  • New_pCAG-loxPSTOPloxP-Lyn-NeonGreen.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Membrane targetting sequence is Lyn (MGCIKSKRKD)