Skip to main content

pX335-NQL003-WAPL-sgRNA2
(Plasmid #175551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175551 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 175551-D50 50 μg of DNA in Tris buffer $495
DNA 175551-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pX335
  • Backbone manufacturer
    Addgene 42335
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use together with pX335-NQL002-WAPL-sgRNA1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9-nickase and sgRNA against mouse WAPL STOP Codon
  • gRNA/shRNA sequence
    TTACCTTTGCTTCAGGTGCT
  • Species
    M. musculus (mouse)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335-NQL003-WAPL-sgRNA2 was a gift from Elzo de Wit (Addgene plasmid # 175551 ; http://n2t.net/addgene:175551 ; RRID:Addgene_175551)
  • For your References section:

    WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation. Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E. Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. 10.1038/s41588-020-00744-4 PubMed 33318687