Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX330-NQL005-SOX2-sgRNA
(Plasmid #175553)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 175553 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Addgene 42230
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
  • gRNA/shRNA sequence
    CAGCCCTCACATGTGCGACA

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-NQL005-SOX2-sgRNA was a gift from Elzo de Wit (Addgene plasmid # 175553 ; http://n2t.net/addgene:175553 ; RRID:Addgene_175553)
  • For your References section:

    WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation. Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E. Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. 10.1038/s41588-020-00744-4 PubMed 33318687