WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation.
Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E
Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. PubMed Article
Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E
Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. PubMed Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 156452 | pEN527 - Rad21-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct | Targeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTG |
| 175549 | pNQL001-WAPL-AID[71-114]-eGFP-FRT-Neo/Kan-FRT targeting construct | Targeting vector to introduce an AID-eGFP cassette at the mouse WAPL locus using Neomycin/Kanamycin selection. Auxin-inducible degron system. |
| 175550 | pX335-NQL002-WAPL-sgRNA1 | For transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct. |
| 175551 | pX335-NQL003-WAPL-sgRNA2 | For transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL002-WAPL-sgRNA1 targeting construct. |
| 175552 | pNQL004-SOX2-FKBPV-HA2-P2A-mCherry targeting construct | Targeting vector to introduce an FKBPV-HA2-P2A-mCherry cassette at the mouse SOX2 locus. Degradation Tag (dTAG) system. |
| 175553 | pX330-NQL005-SOX2-sgRNA | For transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus. |
| 175554 | pNQL006-NANOG-FKBPV-HA2-P2A-eGFP targeting construct | Targeting vector to introduce an FKBPV-HA2-P2A-eGFP cassette at the mouse NANOG locus. Degradation Tag (dTAG) system. |
| 175555 | pX330-NQL007-NANOG-sgRNA | For transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus. |