pJP118
(Plasmid #176494)

• Purpose: Expresses Lifeact-mScarlet under control of the Capsaspora EF1 promoter and HygR under control of the Capsaspora actin promoter
• Depositing Lab: Duojia Pan
• Publication: Phillips et al Elife. 2022 Jun 6;11. pii: 77598. doi: 10.7554/eLife.77598.

Backbone

• Vector backbone: pJP103
• Backbone size w/o insert (bp): 5133
• Total vector size (bp): 5210
• Modifications to backbone: The Lifeact peptide coding sequence from pLifeAct_mScarlet_N1 (Addgene Plasmid #85054) was codon optimized for Capsaspora owczarzaki, synthesized, and inserted into the KpnI site of pJP103 by gibson assembly.
• Vector type: Capsaspora owczarzaki expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lifeact peptide
• Species: Synthetic
• Insert Size (bp): 73

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATTTGGAAATGCTCACTCTTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Lifeact peptide coding sequence was obtained from the sequence of pLifeAct_mScarlet_N1 (Addgene Plasmid #85054)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry