U6-pegRNA-H1-nick sgRNA-mCherry
(Plasmid #176901)

• Purpose: Expresses prime editing guide RNA and guide RNA in mammalian cells
• Depositing Lab: Hyongbum Kim
• Publication: Jang et al Nat Biomed Eng. 2021 Aug 26. pii: 10.1038/s41551-021-00788-9. doi: 10.1038/s41551-021-00788-9.

Backbone

• Vector backbone: px552
• Total vector size (bp): 6551
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 708
• Promoter: CAG

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aaccatgttcatgccttctt
• 3′ sequencing primer: ccacccgtagatctctcg

Gene/Insert 2

• Gene/Insert name: gRNA scaffold
• Species: Synthetic
• Insert Size (bp): 76
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaaagtatttcgatttcttggc
• 3′ sequencing primer: GCCCGCGATTCCTTGGAG

Gene/Insert 3

• Gene/Insert name: gRNA scaffold
• Species: Synthetic
• Insert Size (bp): 76
• Promoter: H1

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGTCTTTGGATTTGGGAAT
• 3′ sequencing primer: gaccccgtaattgattactatt

Resource Information

• Supplemental Documents:
  • U6-pegRNA-H1-nick sgRNA-mCherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry