Venus-7aa-ActA-pEGFP-C1
(Plasmid #177405)

• Purpose: To express Venus fused to mitochondria outer membrane targeting sequence "ActA". Venus faces the cytosol.
• Depositing Lab: David Andrews
• Publication: Osterlund et al Protocol Exchange (2022)

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ActA tail anchor
• Alt name: Venus-ActA, V-ActA, VActA
• Species: Listeria monocytogenes
• Entrez Gene: actA (a.k.a. lmo0204)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-7aa-ActA-pEGFP-C1.gbk
• A portion of this plasmid was derived from a plasmid made by: See gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein. Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of ActA tail anchor sequence: "LILAMLAIGVFSLGAFIKIIQLRKNN", which targets the mitochondrial outer membrane and signal correlates with mitotracker Red signal in cells. "7aa" indicates the 7 aa flexible linker region, "SGLRSRV" between Venus and the ActA targeting signal. This Venus protein contains an F224R mutation to make it monomeric.