mCherry-7aa-ActA-pEGFP-C1
(Plasmid
#177406)
-
PurposeTo express mCherry fused to mitochondria outer membrane targeting sequence "ActA". mCherry faces the cytosol.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameActA tail anchor
-
Alt namemCherry-ActA, Ch-ActA, ChActA
-
SpeciesListeria monocytogenes
-
Entrez GeneactA (a.k.a. lmo0204)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySee gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein. mCherry sequence matches GenBank: AZP55984.1.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express mCherry-fused to the N-terminus of ActA tail anchor sequence: "LILAMLAIGVFSLGAFIKIIQLRKNN", which targets the mitochondrial outer membrane and signal correlates with mitotracker Green signal in cells. "7aa" indicates the 7 aa flexible linker region, "SGLRSRV" between mCherry and the ActA targeting signal.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-7aa-ActA-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177406 ; http://n2t.net/addgene:177406 ; RRID:Addgene_177406) -
For your References section:
Differences in the mechanisms of proapoptotic BH3 proteins binding to Bcl-XL and Bcl-2 quantified in live MCF-7 cells. Aranovich A, Liu Q, Collins T, Geng F, Dixit S, Leber B, Andrews DW. Mol Cell. 2012 Mar 30;45(6):754-63. doi: 10.1016/j.molcel.2012.01.030. 10.1016/j.molcel.2012.01.030 PubMed 22464442