Skip to main content
Addgene
Open Menu

mCherry-7aa-ActA-pEGFP-C1
(Plasmid #177406)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177406 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 177406-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 177406-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ActA tail anchor
  • Alt name
    mCherry-ActA, Ch-ActA, ChActA
  • Species
    Listeria monocytogenes
  • Entrez Gene
    actA (a.k.a. lmo0204)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    See gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein. mCherry sequence matches GenBank: AZP55984.1.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express mCherry-fused to the N-terminus of ActA tail anchor sequence: "LILAMLAIGVFSLGAFIKIIQLRKNN", which targets the mitochondrial outer membrane and signal correlates with mitotracker Green signal in cells. "7aa" indicates the 7 aa flexible linker region, "SGLRSRV" between mCherry and the ActA targeting signal.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-7aa-ActA-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177406 ; http://n2t.net/addgene:177406 ; RRID:Addgene_177406)

  • For your References section:

    Differences in the mechanisms of proapoptotic BH3 proteins binding to Bcl-XL and Bcl-2 quantified in live MCF-7 cells. Aranovich A, Liu Q, Collins T, Geng F, Dixit S, Leber B, Andrews DW. Mol Cell. 2012 Mar 30;45(6):754-63. doi: 10.1016/j.molcel.2012.01.030. 10.1016/j.molcel.2012.01.030 PubMed 22464442
Related items:
Commonly requested with: