Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAS1NB c Rosella I
(Plasmid #71245)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71245 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAS1NB
  • Total vector size (bp) 9040
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rosella
  • Alt name
    DsRed.T3
  • Alt name
    super ecliptic pHluorin (SEP)
  • Species
    Synthetic
  • Promoter PGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer PPGK1-F (cagcctgttctcacacactc)
  • 3′ sequencing primer yPGK1-term-R (AGCGTAAAGGATGGGGAAAG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr B Glick for plasmid pQE31‑DsRed.T3 and Dr J Rothman for plasmid pGEX‑2T‑SEP
  • Terms and Licenses

Depositor Comments

The coding sequence of DsRed.T3 was amplified from pQE31‑DsRed.T326 using the primer pair DsRedTUp2 (5'TAGGATCCCCACTAGTCGCCACCATGGCC TCCTC) and DsRedTDo (5'ATAGTTTAGCGGCCGCTCAGT GATCAGACAGGAACAGGTGGTGG) designed to incorporate 5' BamHI and nested 3' BclI and NotI sites. Following digestion with BamHI and NotI, the amplified gene cassette was subcloned into the multi‑copy yeast expression vector pAS1NB under control of the PGK1 promoter and the resultant vector named pAS1NB‑DsRed.T3. The super ecliptic pHluorin (SEP) gene was amplified from the template pGEX‑2T‑SEP27 using the primer pair PHUp1 (5'GGGATCCTGGTCTTCGGGTGGAAGTAAAGGAG) and PHDo1 (5'‑ATAGTTTAGCGGCCGCTCAGTGATCAGATT TGTATAGTTCATCC) designed to incorporate flanking 5' BamHI and 3' NotI sites. The SEP gene cassette recovered by PCR was digested with BamHI and NotI, and cloned into pAS1NB‑DsRed.T3 digested with BclI and NotI to produce this vector. The expression product from this vector, named the Rosella biosensor, comprises DsRed.T3 fused to SEP with an intervening linker of 9 amino acids (DPWSSSGDL).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAS1NB c Rosella I was a gift from Mark Prescott (Addgene plasmid # 71245)
  • For your References section:

    Rosella: a fluorescent pH-biosensor for reporting vacuolar turnover of cytosol and organelles in yeast. Rosado CJ, Mijaljica D, Hatzinisiriou I, Prescott M, Devenish RJ. Autophagy. 2008 Feb;4(2):205-13. Epub 2007 Nov 21. 5331 [pii] PubMed 18094608