Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84572)


Item Catalog # Description Quantity Price (USD)
Plasmid 84572 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6100
  • Total vector size (bp) 8300
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    microtubule-associated protein 1 light chain 3 beta
  • Alt name
  • Alt name
  • Alt name
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Map1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
  • Tags / Fusion Proteins
    • EGFP (N terminal on insert)
    • mRFP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (unknown if destroyed)
  • 3′ cloning site Bam HI (unknown if destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAAGACGGCAATATGGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-IP-GFP-LC3-RFP-LC3ΔG was a gift from Noboru Mizushima (Addgene plasmid # 84572 ; ; RRID:Addgene_84572)
  • For your References section:

    An Autophagic Flux Probe that Releases an Internal Control. Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, Kodama A, Ishihara T, Mizushima T, Mizushima N. Mol Cell. 2016 Nov 17;64(4):835-849. doi: 10.1016/j.molcel.2016.09.037. Epub 2016 Nov 3. 10.1016/j.molcel.2016.09.037 PubMed 27818143