Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMRX-IP-GFP-LC3-RFP
(Plasmid #84573)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84573 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMRX-IP
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6100
  • Total vector size (bp) 7900
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    microtubule-associated protein 1 light chain 3 beta
  • Alt name
    Map1lc3b
  • Alt name
    LC3
  • Alt name
    LC3B
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1800
  • GenBank ID
    U05784 NM_022867.2
  • Entrez Gene
    Map1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
  • Tags / Fusion Proteins
    • EGFP (N terminal on insert)
    • mRFP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (unknown if destroyed)
  • 3′ cloning site Bgl II (unknown if destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAAGACGGCAATATGGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-IP-GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene plasmid # 84573 ; http://n2t.net/addgene:84573 ; RRID:Addgene_84573)
  • For your References section:

    An Autophagic Flux Probe that Releases an Internal Control. Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, Kodama A, Ishihara T, Mizushima T, Mizushima N. Mol Cell. 2016 Nov 17;64(4):835-849. doi: 10.1016/j.molcel.2016.09.037. Epub 2016 Nov 3. 10.1016/j.molcel.2016.09.037 PubMed 27818143