This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCHAC-mt-mKeima
(Plasmid #72342)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72342 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCHAC-MCS1-IRES-MCS2
  • Backbone manufacturer
    AlleleBiotechnology
  • Backbone size w/o insert (bp) 5632
  • Total vector size (bp) 6517
  • Vector type
    Retroviral
  • Selectable markers
    none

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mt-mKeima
  • Species
    stony coral Montipora
  • Insert Size (bp)
    894
  • GenBank ID
    AB209969

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGACCTGGGAAGCCTTGGCT
  • 3′ sequencing primer TTGCCAAAAGACGGCAATAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The insert mt-mKeima was cut out from the original construct pIND(SP1)-mt-mKeima obtained from Dr. Atsushi Miyawaki of Brain Science Institute, RIKEN, Japan
  • Terms and Licenses
  • Articles Citing this Plasmid

Depositor Comments

Please also cite the original paper describing the use of mt-mkeima by Dr. Atsushi Miyawaki's lab at RIKEN, Japan.
Hiroyuki Katayama et al, 2011. A sensitive and quantitative technique for detecting autophagic events based on lysosomal delivery. Chemistry and Bioogy 18(8): 1042-1052

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCHAC-mt-mKeima was a gift from Richard Youle (Addgene plasmid # 72342)
  • For your References section:

    The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, Sideris DP, Fogel AI, Youle RJ. Nature. 2015 Aug 20;524(7565):309-14. doi: 10.1038/nature14893. Epub 2015 Aug 12. 10.1038/nature14893 PubMed 26266977