Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAS1NB m Rosella I
(Plasmid #71247)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71247 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAS1NB
  • Total vector size (bp) 9209
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rosella
  • Alt name
    DsRed.T3
  • Alt name
    super ecliptic pHluorin (SEP)
  • Species
    Synthetic
  • Promoter PGK1
  • Tag / Fusion Protein
    • yeast mitochondrial targeting sequence of citrate synthase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer PPGK1-F (cagcctgttctcacacactc)
  • 3′ sequencing primer yPGK1-term-R (AGCGTAAAGGATGGGGAAAG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The primer pair CIT2Up (5'‑GAAGATCTAAACAATGTCAG TCGATATTATC) and CIT2Do (5'‑GAGGATCCGTAATTTCA GCAAATCTCTCC) was used to amplify the yeast mitochondrial targeting sequence of citrate synthase flanked by BglII sites from yeast genomic DNA. The resultant PCR fragment, following digestion with BglII, was ligated in‑frame at the 5' end of the Rosella expression cassette.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAS1NB m Rosella I was a gift from Mark Prescott (Addgene plasmid # 71247 ; http://n2t.net/addgene:71247 ; RRID:Addgene_71247)
  • For your References section:

    Rosella: a fluorescent pH-biosensor for reporting vacuolar turnover of cytosol and organelles in yeast. Rosado CJ, Mijaljica D, Hatzinisiriou I, Prescott M, Devenish RJ. Autophagy. 2008 Feb;4(2):205-13. Epub 2007 Nov 21. 5331 [pii] PubMed 18094608