-
PurposeExpression the full-length ectodomain of human LRP1 [residue 1-4414] in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177985 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 177985-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 177985-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEZT-BM
-
Backbone manufacturerRyan Hibbs
- Backbone size w/o insert (bp) 7427
- Total vector size (bp) 20672
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLDL receptor related protein 1
-
Alt nameLRP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)13245
-
GenBank IDNM_002332
-
Entrez GeneLRP1 (a.k.a. A2MR, APOER, APR, CD91, IGFBP-3R, IGFBP3R, IGFBP3R1, KPA, LRP, LRP1A, TGFBR5)
- Promoter CMV
-
Tag
/ Fusion Protein
- No
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer CACTCCCAGTTCAATTAC
- 3′ sequencing primer ACAAATTTTGTAATCCAGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJoachim Herz
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 177985-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 177985-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hLRP1-pEZT-BM was a gift from Lora Hooper (Addgene plasmid # 177985 ; http://n2t.net/addgene:177985 ; RRID:Addgene_177985) -
For your References section:
Serum amyloid A delivers retinol to intestinal myeloid cells to promote adaptive immunity. Bang YJ, Hu Z, Li Y, Gattu S, Ruhn KA, Raj P, Herz J, Hooper LV. Science. 2021 Sep 17;373(6561):eabf9232. doi: 10.1126/science.abf9232. Epub 2021 Sep 17. 10.1126/science.abf9232 PubMed 34529485