Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hRAP-pEZT-BM
(Plasmid #177986)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177986 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEZT-BM
  • Backbone manufacturer
    Ryan Hibbs
  • Backbone size w/o insert (bp) 7427
  • Total vector size (bp) 8519
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LDL receptor related protein associated protein 1
  • Alt name
    LRPAP1
  • Alt name
    RAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1092
  • GenBank ID
    NM_002337
  • Entrez Gene
    LRPAP1 (a.k.a. A2MRAP, A2RAP, HBP44, MRAP, MYP23, RAP, alpha-2-MRAP)
  • Promoter CMV
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CACTCCCAGTTCAATTAC
  • 3′ sequencing primer ACAAATTTTGTAATCCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hRAP-pEZT-BM was a gift from Lora Hooper (Addgene plasmid # 177986 ; http://n2t.net/addgene:177986 ; RRID:Addgene_177986)
  • For your References section:

    Serum amyloid A delivers retinol to intestinal myeloid cells to promote adaptive immunity. Bang YJ, Hu Z, Li Y, Gattu S, Ruhn KA, Raj P, Herz J, Hooper LV. Science. 2021 Sep 17;373(6561):eabf9232. doi: 10.1126/science.abf9232. Epub 2021 Sep 17. 10.1126/science.abf9232 PubMed 34529485