Skip to main content
Addgene
Open Menu

AAVS1_Puro_hPGK1_EGFP_Donor
(Plasmid #178088)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178088 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 178088-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 178088-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 6449
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    H. sapiens (human)
  • Promoter Human PGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer TAGTGTGGGCCCTGTTCCTG
  • 3′ sequencing primer GAGGGGCAAACAACAGATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid derived from AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene 68375). Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1_Puro_hPGK1_EGFP_Donor was a gift from Yannick Doyon (Addgene plasmid # 178088 ; http://n2t.net/addgene:178088 ; RRID:Addgene_178088)

  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338
Related items:
Commonly requested with: