AAVS1_Puro_hPGK1_EBFP_Donor
(Plasmid
#178089)
-
PurposeHDR donor plasmid to introduce the EBFP (T65S/F145Y) cassette to AAVS1 using AAVS1 T2 sgRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 6449
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEBFP (T65S/F145Y)
-
SpeciesH. sapiens (human)
- Promoter Human PGK1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer TAGTGTGGGCCCTGTTCCTG
- 3′ sequencing primer GAGGGGCAAACAACAGATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid derived from AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene 68375). Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1_Puro_hPGK1_EBFP_Donor was a gift from Yannick Doyon (Addgene plasmid # 178089 ; http://n2t.net/addgene:178089 ; RRID:Addgene_178089) -
For your References section:
Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338