pcS-pep1-C1C2
(Plasmid
#178428)
-
Purposepep1 as cell penetrating peptide fused to EV membrane binging domain (C1C2)
-
Depositing Lab
-
Depositing OrganizationMichigan State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 178428-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 178428-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonedownsized pcDNA backbone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepep1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATGTGTCGAGCCACTGGGC
- 3′ sequencing primer AGCATAATCTGGAACATCATATGGATAGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 178428-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 178428-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcS-pep1-C1C2 was a gift from Masako Harada (Addgene plasmid # 178428 ; http://n2t.net/addgene:178428 ; RRID:Addgene_178428) -
For your References section:
Engineering Extracellular Vesicles to Target Pancreatic Tissue In Vivo. Komuro H, Kawai-Harada Y, Aminova S, Pascual N, Malik A, Contag CH, Harada M. Nanotheranostics. 2021 Apr 15;5(4):378-390. doi: 10.7150/ntno.54879. eCollection 2021. 10.7150/ntno.54879 PubMed 33912378