HT107_pAAV_hSyn-DiO-SomQuasAr6a_EGFP-P2A-somCheRiff_HA
(Plasmid
#178826)
-
PurposeCre-on bicistronic expression of QuasAr6b-based Optopatch under an neuronal promoter
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7537
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSomQuasAr6a_EGFP-P2A-somCheRiff_HA
- Promoter hSyn
-
Tag
/ Fusion Protein
- EGFP; HA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer hSyn-F: GAGGAGTCGTGTCGTGCCTG
- 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.11.22.469481 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HT107_pAAV_hSyn-DiO-SomQuasAr6a_EGFP-P2A-somCheRiff_HA was a gift from Adam Cohen (Addgene plasmid # 178826 ; http://n2t.net/addgene:178826 ; RRID:Addgene_178826) -
For your References section:
Video-based pooled screening yields improved far-red genetically encoded voltage indicators. Tian H, Davis HC, Wong-Campos JD, Park P, Fan LZ, Gmeiner B, Begum S, Werley CA, Borja GB, Upadhyay H, Shah H, Jacques J, Qi Y, Parot V, Deisseroth K, Cohen AE. Nat Methods. 2023 Jul;20(7):1082-1094. doi: 10.1038/s41592-022-01743-5. Epub 2023 Jan 9. 10.1038/s41592-022-01743-5 PubMed 36624211