pLentiCrisprV2 sgRNA hPER2c-term #3
(Plasmid
#179456)
-
PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-in
-
Depositing Lab
-
Depositing OrganizationCharite Universitaetsmedizin Berlin
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerZhang lab, addgene #52961
- Backbone size w/o insert (bp) 14873
- Total vector size (bp) 13013
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsOnly amplify in RecA- bacteria
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting human PER2
-
gRNA/shRNA sequenceGGCAGCCAGCGAGGTACACC
-
SpeciesH. sapiens (human)
-
GenBank ID8864
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer --
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDerived from Addgene #52961
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Designed to be used with Addgene #179448-179452
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCrisprV2 sgRNA hPER2c-term #3 was a gift from Achim Kramer (Addgene plasmid # 179456 ; http://n2t.net/addgene:179456 ; RRID:Addgene_179456) -
For your References section:
Live-cell imaging of circadian clock protein dynamics in CRISPR-generated knock-in cells. Gabriel CH, Del Olmo M, Zehtabian A, Jager M, Reischl S, van Dijk H, Ulbricht C, Rakhymzhan A, Korte T, Koller B, Grudziecki A, Maier B, Herrmann A, Niesner R, Zemojtel T, Ewers H, Granada AE, Herzel H, Kramer A. Nat Commun. 2021 Jun 18;12(1):3796. doi: 10.1038/s41467-021-24086-9. 10.1038/s41467-021-24086-9 PubMed 34145278