pcDNA3.1/Puro-CAG-JEDI-2P-Kv
(Plasmid
#179462)
-
PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P expressed under strong mammalian promoter (CAG)
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 179462-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 179462-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
- Backbone size w/o insert (bp) 6095
- Total vector size (bp) 7610
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJEDI-2P-Kv
-
Alt nameJEDI2P-Kv
-
SpeciesSynthetic
-
Insert Size (bp)1515
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 179462-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 179462-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-JEDI-2P-Kv was a gift from Francois St-Pierre (Addgene plasmid # 179462 ; http://n2t.net/addgene:179462 ; RRID:Addgene_179462) -
For your References section:
Sustained deep-tissue voltage recording using a fast indicator evolved for two-photon microscopy. Liu Z, Lu X, Villette V, Gou Y, Colbert KL, Lai S, Guan S, Land MA, Lee J, Assefa T, Zollinger DR, Korympidou MM, Vlasits AL, Pang MM, Su S, Cai C, Froudarakis E, Zhou N, Patel SS, Smith CL, Ayon A, Bizouard P, Bradley J, Franke K, Clandinin TR, Giovannucci A, Tolias AS, Reimer J, Dieudonne S, St-Pierre F. Cell. 2022 Aug 16. pii: S0092-8674(22)00916-3. doi: 10.1016/j.cell.2022.07.013. 10.1016/j.cell.2022.07.013 PubMed 35985322