Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1/Puro-CAG-JEDI-2P
(Plasmid #179458)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179458 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1/Puro-CAG
  • Backbone size w/o insert (bp) 6095
  • Total vector size (bp) 7382
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418), Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JEDI-2P
  • Alt name
    JEDI2P
  • Species
    Synthetic
  • Insert Size (bp)
    1287
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/Puro-CAG-JEDI-2P was a gift from Francois St-Pierre (Addgene plasmid # 179458 ; http://n2t.net/addgene:179458 ; RRID:Addgene_179458)
  • For your References section:

    Sustained deep-tissue voltage recording using a fast indicator evolved for two-photon microscopy. Liu Z, Lu X, Villette V, Gou Y, Colbert KL, Lai S, Guan S, Land MA, Lee J, Assefa T, Zollinger DR, Korympidou MM, Vlasits AL, Pang MM, Su S, Cai C, Froudarakis E, Zhou N, Patel SS, Smith CL, Ayon A, Bizouard P, Bradley J, Franke K, Clandinin TR, Giovannucci A, Tolias AS, Reimer J, Dieudonne S, St-Pierre F. Cell. 2022 Aug 16. pii: S0092-8674(22)00916-3. doi: 10.1016/j.cell.2022.07.013. 10.1016/j.cell.2022.07.013 PubMed 35985322