pAAV-CaMKIIa-JEDI-2P-Kv-WPRE
(Plasmid
#179465)
-
PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKII
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CaMKIIa
- Backbone size w/o insert (bp) 5361
- Total vector size (bp) 6876
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameJEDI-2P-Kv
-
Alt nameJEDI2P
-
SpeciesSynthetic
-
Insert Size (bp)1515
- Promoter CaMKIIa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCTGACGAAGGCTCGCGA
- 3′ sequencing primer caaaggcattaaagcagcgtatc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa-JEDI-2P-Kv-WPRE was a gift from Francois St-Pierre (Addgene plasmid # 179465 ; http://n2t.net/addgene:179465 ; RRID:Addgene_179465) -
For your References section:
Sustained deep-tissue voltage recording using a fast indicator evolved for two-photon microscopy. Liu Z, Lu X, Villette V, Gou Y, Colbert KL, Lai S, Guan S, Land MA, Lee J, Assefa T, Zollinger DR, Korympidou MM, Vlasits AL, Pang MM, Su S, Cai C, Froudarakis E, Zhou N, Patel SS, Smith CL, Ayon A, Bizouard P, Bradley J, Franke K, Clandinin TR, Giovannucci A, Tolias AS, Reimer J, Dieudonne S, St-Pierre F. Cell. 2022 Aug 16. pii: S0092-8674(22)00916-3. doi: 10.1016/j.cell.2022.07.013. 10.1016/j.cell.2022.07.013 PubMed 35985322