This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #113112)


Item Catalog # Description Quantity Price (USD)
Plasmid 113112 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-GINKO1 was a gift from Robert Campbell (Addgene plasmid # 113112 ; ; RRID:Addgene_113112)
  • For your References section:

    Genetically encoded fluorescent indicators for imaging intracellular potassium ion concentration. Shen Y, Wu SY, Rancic V, Aggarwal A, Qian Y, Miyashita SI, Ballanyi K, Campbell RE, Dong M. Commun Biol. 2019 Jan 14;2:18. doi: 10.1038/s42003-018-0269-2. eCollection 2019. 10.1038/s42003-018-0269-2 PubMed 30652129