-
PurposeGenetically encoded green fluorescent potassium ion indicator GINKO2 and red fluorescent pH indicator pHuji fusion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUAST
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepHuji-GINKO2
-
SpeciesSynthetic
- Promoter hsp70 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAACTACTGAAATCTGCCAAG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.10.07.463410v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUAST-pHuji-GINKO2 was a gift from Robert Campbell (Addgene plasmid # 177117 ; http://n2t.net/addgene:177117 ; RRID:Addgene_177117) -
For your References section:
A sensitive and specific genetically-encoded potassium ion biosensor for in vivo applications across the tree of life. Wu SY, Wen Y, Serre NBC, Laursen CCH, Dietz AG, Taylor BR, Drobizhev M, Molina RS, Aggarwal A, Rancic V, Becker M, Ballanyi K, Podgorski K, Hirase H, Nedergaard M, Fendrych M, Lemieux MJ, Eberl DF, Kay AR, Campbell RE, Shen Y. PLoS Biol. 2022 Sep 6;20(9):e3001772. doi: 10.1371/journal.pbio.3001772. eCollection 2022 Sep. 10.1371/journal.pbio.3001772 PubMed 36067248
