pCDH-EF1a-HygroR-T2A-TetOn3G
(Plasmid
#179887)
-
PurposeExpresses TetOn3G transcription factor selectable by hygromycin resistance (Lentiviral vector)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDH
-
Backbone manufacturerSystembio
- Backbone size w/o insert (bp) 6370
- Total vector size (bp) 8250
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetOn3G
-
SpeciesSynthetic
- Promoter EF1a
-
Tag
/ Fusion Protein
- Hygromycin resistance
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCCACGCTTTGCCTGACCCTGCTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lentiviral vector encoding Tet-On 3G constitutively expressed by EF1a promoter. Inducible promoter TRE3GS has to be delivered separately (e.g. DExCon knock in = Doxycycline-mediated endogenous gene Expression Control)
Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EF1a-HygroR-T2A-TetOn3G was a gift from Patrick Caswell (Addgene plasmid # 179887 ; http://n2t.net/addgene:179887 ; RRID:Addgene_179887) -
For your References section:
On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members. Gemperle J, Harrison TS, Flett C, Adamson AD, Caswell PT. Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651. 10.7554/eLife.76651 PubMed 35708998