pJET-62-SFFV-T2A-PuroR-polyA-R11b
(Plasmid #179893)

• Purpose: Donor with homologous arms for Rab11b to knock in SFFV-T2A-Puromycin resistance-PolyA cassette (for knock out)
• Depositing Lab: Patrick Caswell
• Publication: Gemperle et al Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651.

Backbone

• Vector backbone: pJet1.2
• Backbone manufacturer: Thermo Scientific
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 4894
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RAB11B, member RAS oncogene family
• Alt name: H-YPT3
• Alt name: NDAGSCW
• Species: H. sapiens (human)
• Insert Size (bp): 1210
• GenBank ID: NM_004218.3
• Entrez Gene: RAB11B (a.k.a. H-YPT3, NDAGSCW)
• Promoter: SFFV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGACTCACTATAGGGAGAGCG
• 3′ sequencing primer: AAGAACATCGATTTTCCATGGCAG

Resource Information

• Supplemental Documents:
  • pjet-62-sffv-t2a-puror-polya-r11b.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Here donor for integration of SFFV-T2A-Puromycin resistance-PolyA cassette (for knock out) to Rab11b locus

This can be combined with knock in of DExCon module to be able to reversibly rescue Rab11b expression (from the second allele) on demand
DExCon = Doxycycline-mediated endogenous gene Expression Control

https://figshare.com/projects/DExCon_DExogron_LUXon_on-demand_expression_control_of_endogenous_genes_reveals_differential_dynamics_of_Rab11_family_members/118281.

Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.