pMKRQ_11_DExCon-mNeonGreen-R25
(Plasmid #179896)

• Purpose: Donor with homologous arms for Rab25 to knock in DExCon-mNeonGreen module
• Depositing Lab: Patrick Caswell
• Publication: Gemperle et al Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651.

Backbone

• Vector backbone: pMK-RQ
• Backbone manufacturer: GeneArt/Life Technologies
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 4140
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
• Selectable markers: mNeonGreen

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RAB25, member RAS oncogene family
• Alt name: CATX-8
• Alt name: RAB11C
• Species: H. sapiens (human)
• Insert Size (bp): 1839
• Entrez Gene: RAB25 (a.k.a. CATX-8, RAB11C)
• Promoter: TRE3GS
• Tag / Fusion Protein:
  • mNeonGreen (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTCTTATACCAACTTTCCGTACC

Resource Information

• Supplemental Documents:
  • pmkrq_11_dexcon-mneongreen-r25.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Here donor for DExCon Rab25 knock in. DExCon = Doxycycline-mediated endogenous gene Expression Control. Lentiviral delivery of TetOn 3G is also required for this to work.

https://figshare.com/projects/DExCon_DExogron_LUXon_on-demand_expression_control_of_endogenous_genes_reveals_differential_dynamics_of_Rab11_family_members/118281.

Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.