pAR100
(Plasmid #180377)

• Purpose: pAR100 allows cloning of TCRα and TCRβ genes using restriction enzymes (AflII, ApaI, and SacII).
• Depositing Lab: Alec Redwood
• Publication: Sooda et al Commun Biol. 2022 Feb 16;5(1):133. doi: 10.1038/s42003-022-03058-9.

Backbone

• Vector backbone: pSELECT-GFPzeo-mcs
• Backbone manufacturer: Invivogen
• Backbone size w/o insert (bp): 4249
• Total vector size (bp): 7114
• Modifications to backbone: Inserted two multiple cloning sites: one at NheI site (NheI, AflII, ApaI, AscI, BsiWI, BstZ17I, NruI, PstI, SacII, Nhe); another at EcoRI site (EcoRI, KpnI, XbaI, BamHI, SalI, EcoRI); Inserted CD8Aa from pORF9-hCD8Aa (InvivoGen) Inserted NFAT-Luciferase from pGL3-NFAT luciferase
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: NFAT-Luciferase
• Alt name: luc+
• Species: firefly
• Insert Size (bp): 2142
• Promoter: minimal promoter and an NFAT response element

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: kpnI (not destroyed)
• 3′ cloning site: salI (not destroyed)
• 5′ sequencing primer: ACTTGTGGGGTCCTTCTCCT
• 3′ sequencing primer: AATCTCACGCAGGCAGTTCT

Gene/Insert 2

• Gene/Insert name: hCD8A
• Species: H. sapiens (human)
• Insert Size (bp): 719
• Promoter: hEF1-HTLV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: AflII (not destroyed)
• 5′ sequencing primer: AGTGCAGGTGCCAGAACATT
• 3′ sequencing primer: CTTAAGGACGTATCTCGCCGAAAGG

Resource Information

• Supplemental Documents:
  • Protocol
  • pAR100.gbk
• A portion of this plasmid was derived from a plasmid made by: Invivogen

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry