BPK1520-LRRK2-G2019S-ng
(Plasmid
#180436)
-
PurposeTransiently expressing a nicking sgRNA to facilitate the introduction of LRRK2-G2019S mutation in PE3 approach
-
Depositing Lab
-
Depositing OrganizationAlbert Einstein College of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 180436-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 180436-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneBPK1520
-
Backbone manufacturerAddgene Plasmid #65777
- Backbone size w/o insert (bp) 2280
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namencRNA targeting LRRK2-G2019S
-
Alt namePARK8; RIPK7; ROCO2; AURA17; DARDARIN
-
gRNA/shRNA sequenceGACAGACCTGATCACCTACC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneLRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 180436-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 180436-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BPK1520-LRRK2-G2019S-ng was a gift from Frank Soldner (Addgene plasmid # 180436 ; http://n2t.net/addgene:180436 ; RRID:Addgene_180436) -
For your References section:
Highly efficient generation of isogenic pluripotent stem cell models using prime editing. Li H, Busquets O, Verma Y, Syed KM, Kutnowski N, Pangilinan GR, Gilbert LA, Bateup HS, Rio DC, Hockemeyer D, Soldner F. Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208. 10.7554/eLife.79208 PubMed 36069759