Skip to main content

pBPK1520-SNCA-A53T-ng
(Plasmid #181739)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181739 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BPK1520
  • Backbone manufacturer
    Keith Joung (Addgene plasmid # 65777)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Prime editing ngRNA for SNCA-A53T
  • gRNA/shRNA sequence
    GTCATAGGAATCTTGAATACT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter Human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer hU6-F (GAGGGCCTATTTCCCATGATT)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    backbone: BPK1520 from Keith Joung (Addgene plasmid # 65777)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBPK1520-SNCA-A53T-ng was a gift from Dirk Hockemeyer (Addgene plasmid # 181739 ; http://n2t.net/addgene:181739 ; RRID:Addgene_181739)
  • For your References section:

    Highly efficient generation of isogenic pluripotent stem cell models using prime editing. Li H, Busquets O, Verma Y, Syed KM, Kutnowski N, Pangilinan GR, Gilbert LA, Bateup HS, Rio DC, Hockemeyer D, Soldner F. Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208. 10.7554/eLife.79208 PubMed 36069759