pU6-Sp-gRNA-CCR5_DF_A509b_attB
(Plasmid
#182147)
-
PurposeTo insert attB attachment site at CCR5 in human cells via twinPE
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 182147-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 182147-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepU6
- Total vector size (bp) 2326
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCR5-A509b-attB pegRNA
-
SpeciesSynthetic
-
Insert Size (bp)146
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gactatcatatgcttaccgt
- 3′ sequencing primer TCCTGTTACCAGTGGCTGCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The parent vector used for cloning pegRNA constructs via Golden Gate has been deposited to Addgene previously. The name of the parent vector is pU6-pegRNA-GG-acceptor and the Addgene number is 132777.
DNA (Catalog # 182147-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 182147-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-Sp-gRNA-CCR5_DF_A509b_attB was a gift from David Liu (Addgene plasmid # 182147 ; http://n2t.net/addgene:182147 ; RRID:Addgene_182147) -
For your References section:
Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Anzalone AV, Gao XD, Podracky CJ, Nelson AT, Koblan LW, Raguram A, Levy JM, Mercer JAM, Liu DR. Nat Biotechnol. 2022 May;40(5):731-740. doi: 10.1038/s41587-021-01133-w. Epub 2021 Dec 9. 10.1038/s41587-021-01133-w PubMed 34887556