pBK086
(Plasmid #183145)

• Purpose: pET-6xHis-MBP-TEV-MapTIR-APAZ/MapAgo - Heterolgous MapSPARTA expression
• Depositing Lab: Daan Swarts
• Publication: Koopal et al Cell. 2022 Apr 28;185(9):1471-1486.e19. doi: 10.1016/j.cell.2022.03.012. Epub 2022 Apr 4.

Backbone

• Vector backbone: pET-His6-MBP-TEV-LIC cloning vector (1M)
• Backbone manufacturer: Scott Gradia
• Backbone size w/o insert (bp): 6465
• Total vector size (bp): 9397
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MapSPARTA operon (6xHis-MBP-MapTIR-APAZ and MapAgo)
• Alt name: 6xHis-MBP-MapTIR-APAZ
• Alt name: MapAgo
• Species: Maribacter polysiphoniae DSM 23514
• Insert Size (bp): 4062
• GenBank ID: WP_109649956.1 WP_109649955.1
• Promoter: T7
• Tags / Fusion Proteins:
  • 6xHis (N terminal on insert)
  • MBP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gatgaagccctgaaagacgcgcag
• 3′ sequencing primer: tttgttagcagccggatctcag

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry