pBK092
(Plasmid
#183146)
-
PurposepET-6xHis-MBP-TEV-CrtTIR-APAZ/CrtAgo - Heterologous CrtSPARTA expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-His6-MBP-TEV-LIC cloning vector (1M)
-
Backbone manufacturerScott Gradia
- Backbone size w/o insert (bp) 6465
- Total vector size (bp) 9391
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCrtSPARTA operon (6xHis-MBP-CrtTIR-APAZ and CrtAgo)
-
Alt name6xHis-MBP-CrtTIR-APAZ
-
Alt nameCrtAgo
-
SpeciesCrentalea thermophila: DSM 14807
-
Insert Size (bp)4049
-
GenBank IDWP_092459739.1 WP_092459742.1
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatgaagccctgaaagacgcgcag
- 3′ sequencing primer ttcgccaatccggatatagttcc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK092 was a gift from Daan Swarts (Addgene plasmid # 183146 ; http://n2t.net/addgene:183146 ; RRID:Addgene_183146) -
For your References section:
Short prokaryotic Argonaute systems trigger cell death upon detection of invading DNA. Koopal B, Potocnik A, Mutte SK, Aparicio-Maldonado C, Lindhoud S, Vervoort JJM, Brouns SJJ, Swarts DC. Cell. 2022 Apr 28;185(9):1471-1486.e19. doi: 10.1016/j.cell.2022.03.012. Epub 2022 Apr 4. 10.1016/j.cell.2022.03.012 PubMed 35381200