Skip to main content

pPyPGK-HA-EGFP-Myc-TM-IRES-Pac
(Plasmid #183606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183606 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 183606-D50 50 μg of DNA in Tris buffer $495
DNA 183606-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pPyPGK-IRES-Pac
  • Backbone size w/o insert (bp) 5236
  • Total vector size (bp) 6329
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP-TM
  • Species
    Synthetic
  • Insert Size (bp)
    1093
  • Promoter Mouse Pgk1
  • Tags / Fusion Proteins
    • Mouse IgGK signal peptide (N terminal on insert)
    • HA (N terminal on insert)
    • Myc (C terminal on insert)
    • Human PDGFRB transmembrane domain (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATTCTGCACGCTTCAAAAG
  • 3′ sequencing primer GCATTCCTTTGGCGAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The HA-EGFP-Myc-TM cassette was a kind gift of Dr Luis Ángel Fernández (CNB-CSIC).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPyPGK-HA-EGFP-Myc-TM-IRES-Pac was a gift from Sally Lowell (Addgene plasmid # 183606 ; http://n2t.net/addgene:183606 ; RRID:Addgene_183606)
  • For your References section:

    SyNPL: Synthetic notch pluripotent cell lines to monitor and manipulate cell interactions in vitro and in vivo. Malaguti M, Migueles RP, Annoh J, Sadurska D, Blin G, Lowell S. Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226. 10.1242/dev.200226 PubMed 35616331