Skip to main content

pX458-GFP-TRIM28
(Plasmid #185010)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185010 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 185010-D50 50 μg of DNA in Tris buffer $495
DNA 185010-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    px458
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRIM28 sgRNA
  • gRNA/shRNA sequence
    CGTGTGAATGGCGGCCTCGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Trim28 (a.k.a. KAP-1, KRIP-1, MommeD9, Tif1b, Tif1beta)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458-GFP-TRIM28 was a gift from Denes Hnisz (Addgene plasmid # 185010 ; http://n2t.net/addgene:185010 ; RRID:Addgene_185010)
  • For your References section:

    Hijacking of transcriptional condensates by endogenous retroviruses. Asimi V, Sampath Kumar A, Niskanen H, Riemenschneider C, Hetzel S, Naderi J, Fasching N, Popitsch N, Du M, Kretzmer H, Smith ZD, Weigert R, Walther M, Mamde S, Meierhofer D, Wittler L, Buschow R, Timmermann B, Cisse II, Ameres SL, Meissner A, Hnisz D. Nat Genet. 2022 Aug;54(8):1238-1247. doi: 10.1038/s41588-022-01132-w. Epub 2022 Jul 21. 10.1038/s41588-022-01132-w PubMed 35864192